Barcode Identifiers

Sequence ID: GBSP0540-06
Sample ID: AY173425
Identified As: Bugula neritina
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 627
TACTTTTTATTTGGACTATGAGCTGGGATAATTGGTAGAGGTTTAAGAGCTCTTATTCGAGTAGAATTAAGACAACCAGGCAGCTTATTAGGTAAC---GACCAACTTTATAATGTAATTGTCACAGCTCATGCATTTTTAATAATTTTTTTTATAGTCATACCAGTTATAATTGGGGGGTTTGGAAATTGATTGGTTCCCTTGATACTGGGGGCTCCTGATATGGCATTTCCCCGCTTAAACAACATAAGATTTTGGCTTCTCCCTCCAGCATTATTACTTCTATTAATATCTTCTTTAGTAGAGAGGGGAGCTGGAACTGGGTGAACCGTATACCCTCCCTTATCATCGGGCTTAGGTCACAGAGGAGCAGCTGTGGATTTAGCCATTTTCTCTTTACACCTTGCCGGTGTATCCTCAATTTTAGGAGCAATTAACTTTATTACTACAACAATTAATATACGAAGAAACTCTATAAAAATAATTCAAATCCCTTTATTTATTTGGGCAGTTTTTATTACAGCCATTTTGTTACTTTTATCTTTACCAGTGCTAGCTGGAGCTATTACTATACTACTAACCGATCGTAATGTTAATACATCTTTTTTTGACCCTGCTGGAGGGGGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||