Barcode Identifiers

Sequence ID: GBSP0539-06
Sample ID: AY168607
Identified As: Celleporaria oculata
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 429
CTTATACTTCCTTTTTGGCTTTGAGCAGGAATAATTGGTAGAGGTTTAAGAGCACTTATTCGTGTTGAATTAAGCCAACCAGGAGGATTAATAGGAAAC---GACCAACTTTATAACGTTATTGTTACAGCACATGCTTTTATAATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGTTTTGGAAACTGGTTAGTTCCTTTAATATTAGGGGCCCCAGATATAGCTTTTCCTCGTCTAAATAATATAAGGTTTTGATTGCTGCCCCCTGCAGTTTCACTTCTTTTAATATCTTCTATGGTTGAGAGAGGTGCGGGTACAGGTTGAACTGTATACCCTCCTCTATCTTCAAACATCTCACATAGAGGACCTTCCGTCGATTTAGCAATTTTTTCATTACACTTAGCAGGAATTTCATCTATTTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||