Barcode Identifiers

Sequence ID: GBSP0489-06
Sample ID: AY161132
Identified As: Nephasoma rimicola
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 615
GTCTGATCAGGGCTTCTAGGTGCATCAATAAGATTATTAATTCTAACAGAATTAGGTCAACCAGGATCATTATTAGGCAAT---GATCATTTATATAACGTTATTGTAACTGCTCACGCATTTTTAATAATCTTCTTTCTTGTTATACCTGTATTAATTGGGGGATTTGGCAACTGACTATTACCTCTAATAATAAGGGCACCAGACATAGCTTTCCCGCGTTTAAATAACATAAGCTTCTGATTACTTCCCCCTGCCCTTTTATTACTTGTAGCCTCTGCAGCAGTAGAGAAAGGTGTTGGAACAGGATGAACAGTATATCCCCCATTATCAGACGCAATCGCACATTCAGGTCCCTCTGTAGATTTAGCTATTTTCTCCTTACATTTAGCAGGAGTAAGCTCCATCCTCGCATCCTTAAACTTTATTACAACTGTGTATAATATACGCGGTAAAGGTTTCTGAATGCTCCGTGTTCCTTTATTTGTTTGAGCTGTAATACTAACAACAATTCTTCTTTTACTAGCTCTACCTGTTTTAGCTGGAGCTATTACAATACTTTTAACTGACTGTAATTTAAATACCTGTTTTTTTGATCCTACAGGAGGAGGAGAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||