Barcode Identifiers

Sequence ID: GBSP0479-06
Sample ID: AY161122
Identified As: Phascolosoma nigrescens
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 636
ATTTTAGGAATATGGTGTGGTTTAATAGGAACATCCATAAGCCTTCTAATTCGAGCAGAATTAGGCCAACCAGGCTCGCTATTAGGAAGC---GATCAACTCTATAATGTTATTGTAACAGCTCATGCGTTTCTGATAATCTTTTTTTTAGTAATACCTGTCTTAATTGGGGGATTTGGAAATTGATTGATCCCACTAATGATTGGGGCGCCAGACATGGCCTTCCCACGACTAAACAATCTTAGATTTTGACTTCTACCTCCCGCTCTTTGTCTTCTCTTAGCGTCTAGGGCAGTAGAAAAAGGAGTTGGCACGGGATGAACAGTATACCCCCCACTATCAGGAGCCTTAGCACATGCTGGTGCCTCAGTGGATCTAGCTATTTTTTCCCTTCATTTAGCAGGAGTAAGATCTATTTTAGGTGCATTAAATTTTATTTCAACAGTAACTAATATACGTCCAAGAATGCTCTCTTGAGAACGTGTACCATTGTTTGTATGAGCTGCTTTTATTACAGTAATTTTATTACTATTAGCTTTACCTGTTCTAGCGGGAGCCATTACTATACTTCTAACCGATCGAAATTTAAACACCGCCTTTTTCGACCCGGGAGGAGGGGGAGACCCAATCCTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||