Barcode Identifiers

Sequence ID: GBSP0433-06
Sample ID: AM076982
Identified As: Biemna fistulosa
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 862
ACTCTTTATTTATTGTTCGGAGCTTTTGCTGGTATGATAGGGACTGCCTTTAGTATGCTTATTAGGTTAGAACTGTCAGCTCCTGGTTCAATGTTAGGGGAT---GATCATTTATATAATGTTATTGTTACTGCTCATGCTTTTGTAATGATATTTTTTTTAGTTATGCCTGTAATGATCGGAGGATTTGGAAATTGATTTGTACCATTATATATTGGGGCCCCGGATATGGCCTTTCCGAGATTAAATAATATTAGTTTTTGATTATTGCCGCCTGCATTAACTTTATTATTAAGTTCAGCTTTTGTGGAACAGGGAGCAGGAACAGGATGAACTGTTTATCCTCCATTAGCTGGGATTCAAGCTCATTCAGGGGGATCGGTGGATATGGCAATATTTAGTCTTCATTTAGCTGGTTTATCTTCAATATTGGGTGCTATGAATTTTATTACAACTATCTTTAATATGAGAGCACCAGGAATTACAATGGATAGAATGCCGTTATTTGTATGATCTATTTTAGTTACAGCCTTTTTATTATTATTATCTTTACCAGTATTAGCTGGAGGTATAACAATGCTTCTTACTGATCGAAATTTTAATACTGCATTCTTTGACCCTGCTGGGGGAGGGGATCCAATATTATACCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATATTACCAGGATTTGGAATGATTTCACAAATAATTCCAACATTTGCAGCCAAAAAACAAATTTTTGGATATCTTGGTATGGTTTATGCTCTGGTATCAATAGGAATATTAGGATTTATAGTTTGAGCCCATCATATGTTTACAGTAGGTATGGATGTAGATACTAGGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||