Barcode Identifiers

Sequence ID: GBSP0430-06
Sample ID: AM039866
Identified As: Acanthocephalus clavula
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 621
TTGATATATATAGTAGTAGGTTTGTGGGGAGGTTTAGTTGGTTTGTCTTTAAGGTTAGTTGTTCGCATGGAGTTAGGGTCTAGGGGCGTTTGACTAGGTGAT---GAGTATTTATATAATATAGTGGTCAGAATACATGGGGTGATGATAGTATTCTTTTTAGTTATACCTTTCATGATGGGCGGTTTTGGGAATTGAATGATTCCTATTATATTAGGGTTAGGGGATATAGCCTTACCTCGTTTAAATAATTTAAGTCTTTTATTACTATTTGCGGCTTTAGGTCTAAGGGGGTTTTCTATGGTTTTAATAGGGGGTGCG---GCTGGGTGGACAATGTACCCTCCCTTAATATTAAAAAGTTTTAGCTCCAGAGTTTCGGTGGATATAATAGTTTTGAGGCTGCATGTAGTGGGTTTATCTTCTATTTTAGGTTCAATCAATATCATTGTAACATTATTTGCCTATTTTTTACAGGGGGGTGGGTTATTACAAACCCCCTTGTTAGTATGAGCAGAGGTGGTTGCTGCGGGGTTAATTTTACTAACTGTACCAGTGTTGGCTGCTGCTTTAACTATAGTGTTATTGGATCGTAATATGGGGACAAGTTATTTTGACCCA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||