Barcode Identifiers

Sequence ID: GBSP0420-06
Sample ID: AJ843894
Identified As: Pseudaxinella reticulata
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 657
CTTTATTTATTATTTGGGGCATTTGCCGGTATGATAGGAACAGCATTTAGTATGCTTATAAGATTAGAACTATCAGCTCCCGGTACAATGCTAGGTGAT---GATCATTTATATAATGTTATAGTAACAGCCCATGCTTTAGTGATGATATTTTTCTTAGTTATGCCAGTAATGATAGGGGGGTTTGGGAATTGATTTGTACCGTTATATATAGGTGCGCCTGATATGGCTTTCCCAAGATTAAATAATCTTAGTTTTTGAGTATTACCCCCTTCAATTACTTTATTATTAGGTTCTGCTTTTGTAGAGCAAGGAGCTGGGACAGGATGAACACTTTACCCACCCTTAGCAGGCATACAAACACATTCAGGTGGATCTGTAGATATGGCAATATTTAGTCTTCATTTAGCTGGTATATCTTCTATATTAGGGTCAATGAACTTTATTACAACTATTCTAAATATGAGGGCACCAGGGATTACAATGGATAAATTGCCATTATTTGTGTGATCTATTTTAATTACAACTTTTTTATTAATATTAACTTTACCAGTATTGGCAGGTGCGATTACAATGCTTCTTACAGATAGAAATTTTAATACAACATTCTTTGACCCTGCTGGAGGAGGGGATCCGATACTATATCAACACCTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||