Barcode Identifiers

Sequence ID: GBSP0411-06
Sample ID: AJ843885
Identified As: Aiolochroia crassa
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 651
CTTTATTTATTATTTGGAGTCTTTGCTGGTATGATAGGAACAGCATTTAGTATGTTAATTAGACTGGAACTATCTGCACCAGGTTCAATGTTAGGAGAC---GATCATTTATATAATGTTATAGTAACAGCACATGCTTTTGTTATGATATTTTTTTTAGTAATGCCTGTCATGATAGGGGGGTTTGGTAATTGATTAGTTCCATTATATATTGGAGCACCCGATATGGCTTTTCCTCGGTTAAATAATATTAGTTTTTGATTATTACCTCCAGCACTAATTTTATTATTAGGGTCTGCCTTTATAGAACAAGGTGCCGGAACTGGTTGAACGGTTTATCCTCCACTAGCAAGTATACAAACACATTCCGGAGGTTCAGTAGATATGGCAATATTTAGTCTTCATTTAGCCGGAATTTCCTCAATATTAAGTTCTATAAATTTTATAACTACAATTTTAAATATGAGAGCGCCCGGAATGACAATGGATAAATTACCGTTATTCGTTTGATCCATATTATTAACAACAATATTATTAGTTTTAGCATTACCAGTATTAGCTGGAGCGATTACTATGCTTTTAACCGATAGAAATTTTAATACAACATTTTTTGATCCAGCAGGCGGGGGAGATCCTATTTTATATCAACAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||