Barcode Identifiers

Sequence ID: GBSP0405-06
Sample ID: AJ704976
Identified As: Tedania ignis
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 648
TTATTTGGTGGTTTTGCTGGGATGATAGGGACAGCCTTTAGTATGCTAATAAGGTTAGAGTTATCTGCTCCAGGGTCAATGTTAAGTGAT---GATCACTTATATAATGTTATTGTGACAGCCCATGCATTTGTTATGATTTTTTTTTTAGTTATGCCAGTGATGATTGGTGGATTTGGGAATTGGTTTGTGCCTTTATATATTGGTGCGCCGGATATGGCTTTTCCTCGATTAAATAATATAAGTTTTTGGTTATTGCCTCCAGCTTTAAGTTTATTATTGGCTTCTGCTTTTGTGGAGCAAGGGGCAGGTACCGGGTGGACAGTATATCCCCCATTATCTGGGATTCAGGCTCATTCCGGGGGTTCAGTAGATTTGGTTATCTTTAGTTTACATTTAGCGGGTATTTCTTCTATATTGGGGGCTATGAATTTTATAACCACTATAATAAATATGAGGGCACCAGGGATAACAATGGATAGAACGCCATTGTTTGTTTGGTCAATTTTAGTAACTGCGGTTTTATTATTATTATCTTTACCAGTGTTAGCTGGCGCAATTACTATGTTATTAACGGATAGAAATTTTAATACTGCTTTTTTTGATCCAGCAGGTGGGGGGGACCCAATATTATATCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||