Barcode Identifiers

Sequence ID: GBSP0289-06
Sample ID: AF416998
Identified As: Moniliformis moniliformis
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 660
ATCCTGTATATATTATCTGCTGTATGAGGGGGTATGATAGGGTTAATAATGAGTGTAATCATTCGTTTGGAGCTAGGGAGTGTGGGTAGACTTTTGGTGGAT---AATCATCTTTACAATGTAGTAGTAAGATCTCATGCTATTTTGATGATTTTCTTTTTAGTCATGCCTATTACTATAGGGGGGTTTGGAAACTGAATAGTTCCCATCATGTTAGGAGTGGGTGATATAGCTTTTCCACGTATAAATAATTTTAGGTTTTGGCTCCTTCCAGCATCATTGGCGGTTTTTTTAGCATCTTTGCTTATTGACGGG---GCTGCTACAGGATGGACTTTGTATCCTCCCCTAAGGTCCTATGGGTTTAGCAGGGGGATTTCTGTTGATCTAATGATCTTGTCCCTCCATGTAGCCGGATTGTCATCTATTTTAGCTTCTATTAATATAATATCTACAGTATGGGGGGTAAAAGAGATGGGGGTGAGTGTTGAGAAGTTAACTTTATTTGTATGATCATTGCTTGTTACCTCAGGTTTAGTCCTTGTGACAATACCTGTGCTAGCAGCTGCTCTGACGATGCTTTTATTGGATCGTAACTTAATAACAACTTTTTTTGATCCAGCTGGTGGGGGGAGGGCGATTATATTTCAGCATCTGTTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||