Barcode Identifiers

Sequence ID: GBSP0072-06
Sample ID: AF061425
Identified As: Bugula neritina
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 639
TACTTTTTATTTGGACTATGAGCTGGGATAATTGGTAGAGGTTTAAGAGCTCTTATTCGAGTAGAATTAAGACAACCAGGCAGCTTATTGGGTAAC---GACCAACTTTATAATGTAATTGTTACAGCTCATGCATTTTTAATAATTTTTTTTATAGTCATACCAGTTATAATCGGGGGGTTTGGAAATTGATTGGTTCCCTTGATACTGGGGGCTCCTGATATGGCATTTCCCCGCTTAAACAACATAAGATTTTGGCTTCTCCCTCCAGCGTTATTACTTCTATTAATATCTTCTTTGGTAGAAAGGGGAGCTGGAACTGGGTGGACCGTATACCCTCCCTTATCATCGGGCTTAGGTCACAGAGGAGCAGCTGTGGATTTAGCCATTTTCTCTTTACACCTTGCCGGTGTATCCTCAATTTTAGGAGCAATTAACTTTATTACTACAACAATTAATATACGAAGAAACTCTATAAAAATAATTCAAATCCCTTTATTTATTTGGGCAGTCTTTATTACAGCCATTTTGTTACTTTTATCTTTACCAGTGCTAGCTGGAGCTATTACTATACTACTAACCGATCGTAATGTTAATACATCTTTTTTTGACCCTGCTGGAGGGGGAGATCCTATTTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||