Barcode Identifiers

Sequence ID: GBSP0064-06
Sample ID: AF061417
Identified As: Bugula neritina
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 477
TATTTTTTATTTGGACTATGAGCTGGAATAATTGGTAGAGGCCTAAGAGCCCTTATTCGAGTAGAATTAAGACAACCAGGCAGTTTGTTAGGTAAC---GATCAGCTATATAATGTAATTGTCACAGCTCACGCATTTTTAATAATTTTTTTTATAGTAATACCAGTTATAATTGGGGGGTTTGGAAATTGGCTGGTTCCGTTAATATTGGGGGCCCCAGATATAGCATTTCCCCGCCTAAACAACATAAGATTTTGGCTTCTCCCTCCGGCATTATTACTTCTACTAATATCTTCTTTAGTAGAAAGAGGAGCGGGGACTGGATGAACTGTATACCCACCCTTATCATCAGGCTTAGGTCATAGAAGGGCAGCTGTGGATTTAGCCATTTTCTCCTTACACCTTGCCGGTGTATCTTCGATTTTAGGGGCAATTAATTTTATTACTACAACAATTAATATACGAAGAAATTCTATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||