Barcode Identifiers

Sequence ID: GBSP0054-06
Sample ID: AB128060
Identified As: Lingula adamsi
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 654
ATGTATATTTACATAGGGCTGTGGTCTGGGATTTTTGGACTTAGGCTAAGGCATTGTATGCGTATTGAACTTAGTCACCCAGGTGAATGGCTGGAAAGA---AGGATGATGTATCATGGGATTATAACAATACATGCCTTTATGATAATTTTCTTTTTTGTAATGCCAACTAGAATTGGTGGGTTGGGTAATTGATTTCTCCCACTAATATTAAAAATTCAGGATTTGGCTATGCCACGGTTGAACAATGCTAGGATTTGATTTGCACTAGGGGCTTTATTTCTCATATCAATAGCATTTTTAAATAATGTTGGTGTTGGGTGTGGTTGAACTATATATACTCCACTGAGAACTTCAGAGTTTTTAGATGGGATTTCTGTAGATTTAGCTATTTTTTCCCTTCATATGGCTGGGGTTTCTTCAATTGCTGGCAGAATTAACTTTATTGTTACTATTTTTAACATGCGCCTAGGGGCTTTGTTTTTTATAACATTACCTATACTGGTGTGGGCAATGTTTGGGACTTCTGTTTTACTGGTAACCAGGCTTCCCGTATTAGCAGCTGGTTTAACTTTATTAATTTTAGATCGGCATTTTAGGACTAGGTTTTACTATCCTGACGGTGGGGGTGATCCAATTCTTTGACAGCACTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||