Barcode Identifiers

Sequence ID: GBPL0313-06
Sample ID: AY423813
Identified As: Andrya dentata
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 439
AGCTTGTTGGGTTCTATAAAATTTATATGTACGATATATAGTATTTTTAGAAGTAATATC---TCTACGCGTATGTCTATTATACTTTGATCTTACCTTTTTACTTCTATACTTTTGTTGGTTAGTTTACCAGTTTTAGCTTCAGCTATAACTATGCTATTGTTTGATCGTAAATTTGGTTCTGCTTTCTTTGATCCGTTAGGGGGTGGTGATCCTGTTTTGTTTCAGCACATGTTTTGGTTTTTTGGGCACCCTGAGGTGTATGTTTTAATACTACCAGGGTTTGGTATTATTGGGCATATATGTTTGAGGTTAAGTATGATGTCAGATGTGTTTGGTTTTTTTGGGTTGTTATTTGCTATGTTTTCTATTGTATGCTTAGGTAGTAGTGTTTGGGGGCACCATATGTTTACTGTTGGTTTAGATGTTAAGACAGCTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||