Barcode Identifiers

Sequence ID: GBPL0237-06
Sample ID: AY189957
Identified As: Andrya cuniculi
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 442
TCTAGATTGTTAGGATCTATAAAATTTATATGTACTTTATATAATATTTTTAGTAATAATGTT---TCTACGCGTATGTCTATTATTCTTTGATCTTATCTTTTTACTTCAGTTCTTTTATTAGTTAGTTTACCGGTGTTGGCTTCGGCAATAACTATGCTATTGTTTGATCGTAAATTTGGGTCTGCTTTTTTTGATCCGTTGGGCGGTGGTGATCCTGTTTTGTTTCAGCATATGTTTTGATTTTTTGGTCACCCGGAGGTGTATGTTTTAATTTTGCCTGGTTTTGGTGTTATAGGTCATATTTGTTTAAGTTTAAGAATGATGTCTGATGTGTTTGGGTTTTATGGGTTATTATTTGCTATGTTTTCTATAGTATGTCTTGGAAGTAGTGTTTGAGGGCATCATATGTTTACTGTTGGGTTGGATGTTAAGACGGCTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||