Barcode Identifiers

Sequence ID: GBMLB2042-07
Sample ID: AM494910
Identified As: Acesta excavata
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 660
ACTTTATACTTTTTGTTGGGGTTTTGATCTTCCCTGAGAGGAATTAGGTTTAGGTTAATTATTCGTATTCAGCTCTCTCGACCGGGCGAGTGGTTAAACCCA------CAACTATACAATGTAGTGGTAACTAGTCATGCGCTTTTAATAATTTTTTTCTTTGTAATGCCTGTTATAATTGGTGGTTTTGGGAATTGGCTTATTCCTTTGTTGTTGGGAGCGCCGGATATAGCTTTTCCCCGTTTAAATAACTTTAGGTTTTGGCTTTTACCTTTAGCTCTGTATATAATTTTATCGTCTATACGAGTGGACGGGGGTAGGGGAACTGGATGGACTCTTTATCCTCCTCTTTCAGGTCTTTTGGGCTCGGATAGAGCTAGTGTTAACTATAGGATTGTATCATTACATTTGGCCGGGATATCCTCAATAGCTGGGGCTATTAACTTTATTGTTACGTTATATTTAGTTCGACCTAGCGCTATAATTGCGGAACGCATTCCTCTTTATGGATGGTCTATTGCTGTGACTAGAGTTTTACTACTGGTGTCAGTACCTGTTTTAGCTGGGGCTTTGACTATGCTTATTATAGACCGTAATTATAACACTGGGTTTTTTACGCCGGAGGGGGGAGGGGATCCCGTCCTTTTCCAGCATCTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||