Barcode Identifiers

Sequence ID: GBMLB2008-06
Sample ID: NC_008452
Identified As: Acanthocardia tuberculata
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 901
AGTCGATGGTTTTGTAGAACAAATCATAAAGATATTGGAACCCTTTATTTTTACCTGGCCTTTTGGGCTGGTTTGAGGGGGACTTCTTTTAGGATTATAGTCCGTACAGAACTTTCTCGACCATCTTCATGGCTACATAAC---CATGGTCTTTACAATTTAATTATTACCAGGCATGCCTTGATTATAATTTTTTTTATAGTAATGCCTGTGATAATAGGCGGGTTTGGTAACTGGTTAGTGCCTTTAATACTAATAGTTCCGGACATACATTTTCCTCGTCTGAATAATATGAGGTTCTGATTTGTCCCTAACGCTTTAATTTTATTAGCCTTTTCTGGTTTTGTCGAGGGCGGAGTTGGCGCGGGGTGAACTATTTACCCACCATTAACGTCTATTGAATTTTTGGGTGACCCTTCAATAGACCTTGCTATTTTTGCTTTACATTTAGGGGGAATTTCATCAATTGCTGCTAGATTGAATTTTTGTTCAACAGCTATTAACATGCGTCAAAGAGAGCGGTGAATTCATAAGATTCCAATGCTACCAATTTCTTTAGCAATTACAGCTCTTTTATTGATTGTAGCAATGCCCGTTTTAGCCGGCGCTTTAACAATATTACTTTTAGATCGAAATTTCGCTACTAGATTTTTTGATCCGGTAGGAGGCGGGGATCCTATTTTGTTCATACATCTTTTTTGATTTTTTGGTCACCCAGAGGTTTACATTTTAATTTTGCCAGCATTCGGGATTATTTCTCATATTGTAGAAGCTAATTCTGGGAAGAAAATGCTCTTTGGAAAGTTGCCAATGATTTACGCAATAGCATCTATTGGATTTTTAGGTTTCATTGTGTGGGGTCATCACATGTTTACCGTAGGTTTAGACGTGGACACTCGAG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|