Barcode Identifiers

Sequence ID: GBF221-08
Sample ID: DAOM227046.ITS
Identified As: Arthrobotrys superba
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 538
CATTACCAAAGAGTGAGAAATCGCTCTCTACCTGCTCGGTGGCCCTTGGGTCGCTGACCGGTCTACCCTTTGTGAACCAAAAAACCTTTTCGCTTCGGCAGCTGGGTGTAACCGCCCGTCAGCCTGCCGCTAGCACCAACCTTTAAAACCTGTTGTCAAACATTGTCTGATAACCAAATTTTCGAATGAAAATTAAAACTTTCAACAACGGATCTCTTGGTTCCCCCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCATTGGTATTCCTTTGGGCATGTCTGTTTGAGCGTCATTACAACCCTCAGCCAACCGCTGGTCATGGACCTGAACGGGGTAACACCCGAGCCGGTCTAAAAGTTGTAAGCTCTGCTGGCCGCTCTGCCCAACCGGAACATAGTAAAACACTACTTGTTGGGGTGAAGCTGAACGGTACGGCCTGAACAAAACCTACCCATTTCTAAGGTTTGACCTCAGATCAGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||