Barcode Identifiers

Sequence ID: GBF202-08
Sample ID: DAOM176858A.ITS
Identified As: Angulimaya sundara
Last Updated
Marker ITS

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 506
CATTACAGAGTTGCAAAACTCCCAAAACCATCGCGAACGTTACCAGTAACCGTTGCTTCGGCGGGGGGCTCCAGGGCGGAGCCGTAGCCCCTCACGGGGCGCCCGCCGGAGGACAAATACCAAACCATTTTATCTTTAAGGCATCTCTGAGTTATTTTATAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCGGCTTGTGTTGGGGCCCTGCGGCTGTCCGCAGGCCCTTAAAACCAGTGGCGGGCTCGCTGTCACTCCGAGCGCAGTAATACATCTCGCTTTGGTCGTGCAGCGGGTACCGGCCGTTAAACACCCCCCTTTTATCAAGGTTGACCTCGGATCAGGTAGGAATACCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||