Barcode Identifiers

Sequence ID: GBF141-08
Sample ID: DAOM226822.ITS
Identified As: Acrodontium salmoneum
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 519
CATTACCGAGTTTAACTCGCCAACCCCCTGTGAACATACCTCAGTTGCTTCGGCGGACCCGCCCCGGCGCCCTCGGGCCCGGACCAGGCGCCCGCCGGAGGACCCCAAACCACTGAATTACCATGTGTATCTTCTGAGAAAAAGGCGAAAGCCGAAAATGAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAGCTCAGTGAACCATCGAATTTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCCTCGGGCCCCCTTCACGGGGCGGCCCGGTGTTGGGGATCGCCCGCCCCTCGCGGCGGGCGTCCCTCAAATCTAGTGGCGGACCTTCCGCGCCTCCCTTGCGTAGTACTGCACCTCGCACCGGAGCGCGCTGGGGCCCTGCCGTTAAACCCCCCACTTCTCAAGGTTGACCTCGGATCAGGTAGGAATACC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||