Barcode Identifiers

Sequence ID: GBF134-08
Sample ID: DAOM226647.ITS
Identified As: Acrogenospora gigantospora
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 564
CATTACCGAGCGCCCTCGGCCCTAACCGGGCCAGGCCTCCCATCCCGTGCCTGAACCCCTCTCTCCTTCCCTCCCGGGGGCGCGCCCCAAAAGGCCGCCCCCGGAAGGCAGAGGGCCACCGCCTCCTCTTCGGGCCCTAGGGCCCCGGAGCCGGCGGAGGACCCCCTAAAACCCTCGCGAAACCTACAGTCTGAGCGGCTCATGCCAAACCTAAATACAACCTGCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGCGAATCGCAGATCTCAGTGAGTCATCGAATTTTTGAACGCATATTGCGCCCTCTAGTATTCTGGAGGGCACGCCTGTCCGAGCGCCATTTTCAACCTCGAGCCCCCGGGCTCAGTGTTGGGCGTCGCCCGAGAGGGCCCGCCCCAAACGTGTCGGCGCCGCCCGCCGGAACCCAGCGCACCGTGCCTAACCGCCCGCGCGAAGGTCCCGGGGGGTGGCCGCCCGCAGCTAGCGCCCTGGCGCAACAAAGCATGGCCTCGGATCAGGCGGGGCTACCCGC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||