Barcode Identifiers

Sequence ID: GBF114-08
Sample ID: DAOM226833.ITS
Identified As: Acremonium curvulum
Last Updated
Marker ITS

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 487
CATTAGCAGAGYYYCTAACTCACAAYCCATCGTGAACATACCTTTGTTGCTTCGGCGCGCTTCACGGCCGCCGAAGACCCTAAACTCTTGTTTTTACATGTGTTACTCTGAGTAATTCTTGAAATAAATCAAAACCTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTACTCCGGCGGGCACGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCTCCTTCGGGATGGGCCTGGTGTTGGGGCTCGGCCGCCATCTCCGGCGGCCGTCCCCTAAATACAGTGGCGGTCACGTCGCGACTCCTTTGCGTAGTAGAAACACCTCGCTCCGGATAGCAACGCGGTCCACGCCGTAAAACCCCCAATTTTCAATGGTTGACCTCGGATCAGGTGGGAATACCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||