Barcode Identifiers

Sequence ID: GBF035-08
Sample ID: KAS759.ITS
Identified As: Arthroxylaria elegans
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 552
CATTAAAGAGTTCTAACAAACTCCCAAACCCATGTGAACATACCTTACGTTGCCTCGGCAGGTCGCGGCCTACCCGGTAACCCCCTACCCTGGGGGACCTACCCGGGAAGACGCGGTTCCAGCCTGCCGACGGCCCAGCAAACTCTGTTTAGCATTGAAAATCTGATTTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCCAGTTGCTTAGCGTTGGGAGCCTACGGTTTCAGCGTAGCTCCTCAAAGTTAGTGGCAGAGTCAGTCCGCACTCTAGGCGTAGTAATTTCTATCTCGTCTTTGCAGTCGTGCTGCCGCTCGCCGTAAAACACCCCAATTTATAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||