Barcode Identifiers

Sequence ID: GBCO107-07
Sample ID: DQ518746
Identified As: Acanthanura sp. RCG-2005
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 453
CTAATGATTGGAGCTCCTGACATGGCTTTCCCTCGTATAAACAACATAAGTTTTTGGCTTCTACCTCCATCCTTAACCCTTCTTTTATCAAGAGGACTCGTAGAAAACGGAGCAGGAACAGGATGAACAGTCTACCCTCCTCTATCCTCTAACTTAGCTCATGCTGGTAGATCAGTGGATTTAACCATTTTTAGCCTCCATTTAGCCGGAGCCTCCTCCATTCTAGGAGCCGTAAATTTTATCACCACCATCATTAATATACGGTCAATCGGCATGTCCTGAGATCAAATACCTTTATTTGTTTGATCTGTCTTTTTAACTGCTATCCTTCTTCTTCTTTCTTTACCTGTTCTAGCCGGAGCCATCACTATACTGCTCACTGATCGTAACCTAAACACCTCTTTTTTTGACCCCGCTGGTGGAGGAGACCCAATTCTTTACCAACATCTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||