Barcode Identifiers

Sequence ID: GBCI787-07
Sample ID: EU012503
Identified As: Aequorea conica
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 540
GATATTGGTACATTATATATTGTATTTGGTGCTTTTTCTGGTATGGTAGGAACTGCTTTAAGTATGTTAATCAGATTAGAATTAGCCGGACCCGGACCTATGTTTGGGGAC---GATCACTTATATAATGTCATTGTAACAGCTCATGCTTTTGTCATGATTTTCTTTTTAGTTATGCCAGTTTTAATAGGAGGTTTTGGTAATTGATTTGTTCCATTATATATTGGAGCCCCTGATATGGCATTCCCTAGATTAAATAATCTTAGTTTCTGATTATTACCACCTGCTTTATTATTATTATTAGGTTCCTCCTTAATCGAACAAGGTGCAGGTACAGGTTGAACAGTTTATCCTCCTTTATCAGGTCCACAAACTCACTCTGGAGGTTCTGTAGATATGGCTATTTTTAGTTTACATTGTGCAGGAGCTTCTTCAATAATGGGAGCTATAAACTTTATTACAACTATTTTTAATATGAGAGCTCCTGGTTTGACTATGGACAAACTTCCTTTATTCGTTTGATCTGTATTAATTACAGCC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||