Barcode Identifiers

Sequence ID: GBA2756-07
Sample ID: AF002653 U29710
Identified As: Limulus polyphemus
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 489
C-I---CCGCGATGACTTTATTCAACAAATCACAAAGACATTGGAACAATATATCTAATTTTTGGAATTTGAGCCGCAATAGTAGGGACAGCTCTCAGAATCTTAATTCGAGCCGAACTTGGCCAACCTGGCTCATTAATTGGAGAT---GATCAAATTTACAACGTAATTGTTACAGCCCACGCATTCGTAATAATTTTTTTTATAGTTATACCTGTAATAATCGGAGGATTTGGAAACTGACTTATTCCTCTAATATTAGGGGCCCCTGATATAGCTTTTCCCCGACTCAATAACATAAGCTTTTGACTTCTCCCCCCATCTTTTCTTCTATTACTCAGATCAGCTGCAGTAGAAAGAAGAGCAGGAACAGGTTGAACTGTATACCCTCCTCTAGCATCAGGTATAGCTCACGCAGGAGCCTCAGTAGACTTGACAATCTTTTCTCTCCACTTAGCAGGAGTATCATCAATTTTAGGTGCNATTAAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||