Barcode Identifiers

Sequence ID: DSCRA047-06
Sample ID: INV0794c
Identified As: Acanthephyra curtirostris
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 650
TATATTTCATCCTTGGAGCATGAGCTGGAATGGTAGGTACCGCCCTAAGCCTTTTGATCCGGGCCGAACTCGGCCAACCAGGAAGCTTAATCGGAAACGATCAAATCTACAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTCTTTATAGTTATGCCGATTATAATTGGTGGCTTCGGAAACTGATTACTCCCCCTTATACTAGGAGCCCCTGATATAGCCTTCCCTCGAATAAACAACATAAGATTCTGGCTACTGCCCCCATCCTTAACCCTTTTACTCTCTAGAGGAATAGTAGAAAGGGGGGTTGGTACTGGATGAACTGTTTACCCCCCACTAGCTGCTGGGATCGCCCATGCTGGAGCTTCTGTTGATATAGCAATTTTCTCGCTCCATTTAGCTGGTATCTCTTCAATTCTAGGCTCCGTTAATTTCATAACCACAGTTATTAATATACGAAGAAGAGGAATGACGATAGACCGAATCCCCTTATTCGTTTGATCGGTGTTTTTAACCACAATCTTACTCCTACTCTCCCTACCTGTTCTAGCGGGAGCTATCACAATACTACTCACAGATCGAAACTTAAACACCTCCTTCTTTGACCCGGCTGGGGGAGGAGACCCAATTCTCTACCAACATTTA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||