Barcode Identifiers

Sequence ID: DLPR087-10
Sample ID: OLI-Peri-carch-SR12
Identified As: Carchesium polypinum
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 661
AATACTGAACTACTGAAGTCAAAACTTCTTTTTTTTCTGGATTAACTAAAGTGGATAATTTTTTACAACAATATAAATACGATGAAATTTTTCATAATATTAAAAAATCTATTAGTAATTACGATTATTCAAGATTAGAATTATTAGTAAAAGATGCTACA------AAAGATATTGATAAAAAACTACATGATTTTGTTACTTATAGAAAATTGAGAGATCAGGCTATTCTTGATGCTGAATTACACAAAGGAATGAAATATAATCTAAATATTTTCGATGAAAATTTTTATAGTTATAAGTTAATTTTTTGAAAAGATATTTATAATTCTACTGATACTTTTTGATCATTAACAAAAAATGCTTTAAAGTTTAAAAGACAAAAAAGATTTTTAGTTAAATGTATTAGTGCTAACCAAACAGTTGCTGGTTGAACTTTTATTACACCATTTTCATCAAATACAGAATATACGGGATTTGGTATTCAAGATATGTTAATTTTAGGGGTATATTATGCTGGTATTAGTACAACTATTAGTTTAGTTAATTTATTAATAACTAGAAGAACTTTATCTATGCCTGGTTTAAGAAATAGAAGAATTTTATTACCATTTATTACAATTACACTTTTATTGATGTTACGTGCTTTATCTGTAATTAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||