Barcode Identifiers

Sequence ID: CYAF176-10
Sample ID: PR831
Identified As:
Last Updated
Marker rbcLa

Nucleotide Sequence

Residues: 552
AGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTACACTCCTGAATATAAAACCAAAGATACCGATATCTTGGCAGCGTTCCGAGTAACTCCCCAACCTGGGGTGCCCGCTGAGGAAGCGGGGGCTGCAGTAGCTGCTGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGGGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTCTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTAGAAGATTTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCCTATTGGGATGTACCATTAAACCAAAATTGGGTTTATCTGCCAAAAACTATGGTAGAGCAGTTTACGAATGTCTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||