Barcode Identifiers

Sequence ID: CTM025-10
Sample ID: CTM0025
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 661
AACCCTGTATTTTATTTTTGGAATTTGAGCGGGTTTTATTGGTTTAAGTATAAGTTTATTAATTCGATTAGAGTTAGGAGTTGTAGGTCCTTATCTAGGTGATGAGCATCTTTATAATGTGTTAGTTACGGCTCATGCATTTGTCATAATTTTCTTTATAGTTATGCCTATTTCAATAGGAGGTTTTGGTAATTGGCTTATTCCTTTAATACTTGGTGTTGCTGATATAGCTTTCCCTCGTATAAATAATCTTTCCTTTTGACTTTTAATACCATCCTTCTTATTCTTATTACTTTCTTCTATTTTAGACGCAGGAGTAGGTACTGGTTGAACTGTTTATCCTCCTCTTTCTGACTCTAAATATCATAGAGGTATTTCAGTTGATTTAGCTATTTTTAGCTTGCATCTAGCTGGGATTTCTTCTATTTTAGGAAGGATTAATTTTTTAACCACTATTATTTGTTCTCGTACTACAAAAATAATTTCTTTAGATCGTTTACCTTTATTTCTTTGAGCAGTAGCCGTTACAGCAGTTTTATTAATTACTAGATTACCTGTTTTAGCTGGAGCTATTACTATGCTTCTTACAGATCGTAATTTTAATACTACTTTTTTTGATCCTGCAGGAGGGGGTAATCCTGTTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||