Barcode Identifiers

Sequence ID: CRYPT004-07
Sample ID: CCMP1221
Identified As: Chroomonas sp.
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 675
TACGTTATATCTTATTTNTGCTATTTTTGCAGGTGTTGTTGGTACAGCACTTTCAGTTTTTATTAGAATGGAGCTNGCTGGGCCAGGCATCCAAATTTTAGGTGGAAATCATCAGTTGTATAATACAATCGTGACAGGACACGCCTTTGTTATGATCTTCTTTATGGTTATGCCAGCTTTAATTGGAGGCTACGGAAATTGGTTTGTTCCAATAATGATTGGCGCACCAGACATGGCATTTGCTAGACTAAATAACATCTCGTTTTGGTTATTGCCGCCTGCTTTTATATTATTGTTAAGTTCTACGTTAATTGAAACAGGTGTCGGGACAGGTTGGACAGTTTATCCACCGTTAAGTAGTATTGAAGGTCATCCCGGGGCCGCTGTAGACTATGGAATTTTTTCCTTACATGTAGCTGGTGCTTCAAGTATTCTTGGTGCTATCAATTTTATCACGACTATTTTTAATATGCGAGCACCTGGTATGACTATGCATAGACTTCCTTTGTTTGTTTGGGCTGTCTTAATCACGGCTTTTTTGTTGTTGTTATCATTACCAGTTTTCGCTGGTGCTATTACAATGTTGCTAACAGATAGAAACTTTAATACAGGTTTTTTTGATGCTGCAGCTGGCGGCGACCCTGTTTTGTATCAACATCTGTTTTGGTTTTTTGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||