Barcode Identifiers

Sequence ID: CPTO004-09
Sample ID: UTEX 2422
Identified As: Chroomonas sp.
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 596
GTTGTGGGAACAACTCTTTCAGTTTTAATAAGAGCTGAACTTTCTGGTCCTGGTGTACAAGTTTTAGGTGGTAACCATCAACTTTATAATGTGATCGTAACTGGTCATGCTTTTATAATGATATTTTTTATGGTGATGCCTGCTTTAATTGGAGGTTATGGTAACTTTTTAGTTCCTATTATGATTGGTGCTGTTGATATGGCATTTCCAAGAATGAATAATGTTAGTTTTTGGCTTTTACCACCAGCGTTATTATTATTAATTAGTTCTACTTTAACAGAAGGTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTGAGTAGTGTTGAAGGTCACCCAAGTGCTGCGATCGATTTAGGAATTTTTAGTTTACATGTTGCGGGAGCTTCTTCTATTTTAGGTGCTATTAATTTTATTACGACAATTTTTAATATGCGATGTCCTGGTATGACATTTCATAGATTGCCTCTTTTTGTTTGGGCAGTTTTAATTACAGCATTTTTATTACTTTTATCTTTACCTGTTTTTGCGGGAGCAATTACAATGTTATTAACAGATAGAAATTTTAATACAACATTCTTTAATCCAGCCGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||