Barcode Identifiers

Sequence ID: CEFI033-09
Sample ID: P354A8
Identified As:
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 561
ATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGTCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATCGTTGCTTCGGCGGATCCGCCCCGGCGCCCTCGGGCCCGGATCAGGCGCCCGCCGGAGACCCCAAACTCTTGTATTTCTTTAGTATCTTCTGAGTAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGCTCGGCCCGTCCCTCGCGGCGCGCCGTCCCCGAAATCCAGTGGCGGTCACGCTGTACTCCTCTGCGTAGTAATCCAACCTCGCAACGGGACAAAGCCTGGCCACGCCGTTAAACCCCCCACTTCTGAAGGTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||