Barcode Identifiers

Sequence ID: CEFI005-09
Sample ID: P203A2
Identified As:
Last Updated
Marker ITS

Nucleotide Sequence

Residues: 572
GTAACAAGGTTTCCGTAGGTGAACCTTCGGAGGACATTACCGTAACGCGGCGGTCCGGCAACCGCAAGGAAGTCGGCCGCCACACGCGTTTATCACCCTTGACTTTGAGCACCTTTCGTTTCCTCGGCGGGTTCGCCCGCCAGCGAGGACCCCCACAAACCCTTTGTAATAGCAATATTTGTCTGAAAAACAACCAATAATCAAAACTTTCAACAATGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGTGGGGCATGCCTGTTCGAGCGTCATTTAACCCCTCAAGCCTAGCTTGGTATTGGGTGCTTGTCCCGCCTCTCGCGCGGCGACTCACCTCAAAGTCATTGGCAGCCCGCATCTCGCCGGCCGTGAGCGCAGCACAGACGCGCTCTTGGCAACGACGGATCGGCTCTCCAAAAGCTTATTCAACCACTGACCTCGGATCAGGTAGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||