Barcode Identifiers

Sequence ID: CBOLN002-07
Sample ID: OLI-Anophr-haem-01
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 934
TAGCTACTATGATTAGACTAGAATTAGCACATCCAGGAAGTCCATTTTTTAAAGGAGACTCATTACGTTATTTACAAGTTATTACTGCCCATGGTTTAATTATGGTGTTTTTTGTTGTTGTGCCAATTATTTTTGGAGGTTTTGCAAATTTTTTAATTCCGTATCATATCGGTTCTAAAGATGTTGCGTACCCTAGATTAAATAGTATTGGTTTTTGAATACAACCTTGTGGTTTTATTTTAGTTGCAAAAATTGCATTTTTAAGGCCTCAACATTGAAGATATTATGATAAAGTATCTTATTACTTCCCATTATTAGAAAAATCGCATAATAGAAAATATGCAGAATTTAATAATAATGAAAATATTTTCCAATTAAGAGCTCTAAAAAGATATTTTTTAGACGAACACACTATTTTCCAATTAACTAAAAATAAAGAAGTTTTACCGAATTATGAAGATTACTCTAGTACACCTTTGAAATTATTATTTTGAAAGGATGTTATAAATTACCCAGAATCTTTTTGATACGCTATTAGTAGAATTAATAAAATTAGACGTAAAAAAGTTTACTTTACTAAGTGTTCAAATAGTACATTAACTACTGCAGGTTGAACATTTATTACACCGTTTGCGTCAAATACTAAATATTCAGGAGTAGGAGCTCAAGACTTGTTATTAGTATCTGTAATATTTGCAGGTATTAGTTCAACAGTTTCATTTACTAACCTATTAATTACTAGGAGGACTTTATGTATGCCTGGTATGAGACATAGGAGGGTGTTATTACCATTCGTTACTATTGGTATTTTTTTTGCCTTAAGAATGTTAGCGATAATTACTCCAGTATTGGGTGCTGCTATGATTATGATGGCTTTAGACCGTCATTGACAAACAACCTTTTTTGATTTTGCTTATGGAGGTGATCCTAATAC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||