Barcode Identifiers

Sequence ID: CAR348-11
Sample ID: A30-PM
Identified As: Cerdocyon thous
Last Updated
Marker atp6

Nucleotide Sequence

Residues: 126
TTCGCTGCCCCCTCAATAATAGGCCTTCCTATTGTAATCCTAATCATTATATTCCCATCCATTCTATTTCCATCATCTAATCGTCTAATCAACAATCGATTAATTTCTATCCAACAATGATTGATT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||