Barcode Identifiers

Sequence ID: ASTAV212-06
Sample ID: DHJPAR0006970
Identified As: Patelloa xanthuraDHJ01
Last Updated
Marker COI-5P

Sequencing Runs (Forward)

If you see this text, it means that you are not using a java capable browser. Sorry!

Sequencing Runs (Reverse)

If you see this text, it means that you are not using a java capable browser. Sorry!

Nucleotide Sequence

Residues: 657
ACTTTATATTTTATTTTTGGAGCTTGATCTAGAATAATTGGAACTTCTTTAAGAATATTAATTCGAATTGAATTAGGTCATCCAGGTTCCTTAATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAATGAATAATATAAGTTTTTGACTTCTTCCTCCTGCTTTAATACTTTTATTAACAAGTAGAATAGTAGAAAGTGGAGCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATCTATTATTGCTCATGGAGGAGCATCTGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTATTGGTATTACCTTTGATCGAATACCTTTATTTGTTTGATCAGTTGCTATTACAGCCTTATTACTTTTATTATCTTTACCAGTTTTAGCTGGAGCAATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||