Barcode Identifiers

Sequence ID: ASTAI169-06
Sample ID: DHJPAR0005741
Identified As: Patelloa xanthuraDHJ01
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 657
ACTTTATATTTTATTTTTGGAGCTTGATCTAGAATAATTGGAACTTCTTTAAGAATATTAATTCGAATTGAATTAGGTCATCCAGGTTCCTTAATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAATGAATAATATAAGTTTTTGACTTCTTCCTCCTGCTTTAATACTTTTATTAACAAGTAGAATAGTAGAAAGTGGAGCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATCTATTATTGCTCATGGAGGAGCATCTGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTATTGGTATTACCTTTGATCGAATACCTTTATTTGTTTGATCAGTTGCTATTACAGCCTTATTACTTTTATTATCTTTACCAGTTTTAGCTGGAGCAATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||