Barcode Identifiers

Sequence ID: ASEND151-10
Sample ID: B-OHWE09-2.w
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 632
ATTAGCTGGAATTATTGGTGGATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCGTTTCCTCGTATGAATAATTTGAGTTTCTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTCTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTTTATCACAGGTAATGTCCCATCCAAGTGCAGGAGTTGACATTGCTATACTTGCACTCCACGTTGCTGGTATGTCGTCAATTGTTGGGGCGATCAACTTTATAGTTACTATATTTAACATGCGCGCAAAAGGCATGTCATTAACTAAGATGCCACTGTTTGTTTGGTCTGTCTTGTTAACAGCATTTATGTTGATTGTTGCCTTACCAGTGCTTGCCGGTGCTATAACTATGCTTCTTACTGATCGCAATATTGGTACTTCCTTTTTTGATCCTGCCGGTGNCGGCGATCCTGTGTTANTTCAACATCTAT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||