Barcode Identifiers

Sequence ID: ASEND012-09
Sample ID: ASMET184-09.w
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 587
GCTGGAATTATTGGTGGATTATTATCGGTGATTATTCGCACTCAGCTAATGCACATTAATATACTTAACAATAACTATCAATTATATAACGTAATGGTTACAGGGCATGCGTTGATAATGGTGTTTTTTATGATAATGCCAGCCCTCATGGGAGGATTTGGTAACTGGTTTGTACCTCTCATGATTGGCGCACCAGATATGGCATTTCCTCGTATGAATAATTTAAGTTTTTGGTTATTAGTGTCATCTTTTATTTTGCTCATTCTCTCAGTGTTTATTGGTGAAGGTCCAGGTACAGGTTGGACTTTATATCCACCTCTATCACAGGTAATGTCCCATCCAAGGGCAGGAGTTGACATTGCTATACTTGCACTTCATGTTGCTGGTATGTCGTCAATTGTTGGAGCGATCAACTTTATAGTTACTATATTTAACATGCGCACAAAAGGAATGTCATTAACTAAGATGACACTGTTTGTTTGGTCTGTCTTGCTAACAGCATTTATGTTGATTGTTGCCTTACCAGTGCTTGCCGGTGCTATAACTATGCTTCTTACTGATCGCAATATAGGTACTTCCTTTTTTGA
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||