Barcode Identifiers

Sequence ID: ABMMC2936-08
Sample ID: GWS009708
Identified As: Pyropia perforata
Last Updated
Marker rbcL

Nucleotide Sequence

Residues: 1363
TTACTGGGATGCTGATTATGTAATAAAAGACACAGATGTTTTAGCTCTGTTTAGAATCACTCCTCAGCCAGGCGTAGATCCTATTGAAGCATCTGCTGCAATTGCAGGTGAGTCTTCAACAGCTACTTGGACAGTTGTATGGACTGATTTGCTAACAGCTTGTGATTTATATAGAGCAAAAGCGTATAGAGTAGATCCAGTTCCGAACGTTGCAGATCAATACTTTGCTTATATTGCTTACGATATTGATTTATTTGAAGAAGGTTCCATTGCAAACTTAACTGCCTCAATTATTGGGAATGTTTTCGGATTCAAAGCAGTTAAAGCTCTTCGTTTAGAAGATATGCGTATGCCGGTAGCTTACCTAAAAACTTTCCAGGGGCCAGCAACTGGACTGATTGTAGAACGTGAGCGTATGGATAAATTTGGCAGACCTTTCTTAGGTGCAACAGTTAAGCCTAAACTAGGCCTATCTGGCAAGAATTACGGAAGAGTAGTATATGAAGGTTTGAAAGGTGGTCTTGACTTCCTTAAAGATGATGAAAATATTAACTCACAACCATTCATGCGTTGGAGAGAAAGATTTCTATATTCCATGGAAGGTGTCAATAAAGCATCTGCATCTGCTGGTGAGATTAAAGGTCATTATCTTAATGTCACAGCTGCAACTATGGAAGATATGTATGAAAGAGCAGAATTTTCCAAAGAGGTTGGTAGTATCATTTGTATGATCGACCTTGTAATTGGTTATACCGCTATTCAAAGCATGGCAATATGGGCTCGTAAACATGATATGATTTTACATTTGCATAGAGCAGGTAACTCTACTTACTCTCGCCAAAAAAATCATGGTATGAATTTCCGAGTTATTTGTAAATGGATGCGTATGGCTGGTGTTGATCATATTCATGCAGGTACAGTAGTAGGTAAACTTGAAGGAGATCCTTTAATGATTAAAGGTTTCTATAACACTTTACTTGAAAGTGAAACAGATATTAATCTACCTCAAGGTTTATTCTTCGCTCAAAACTGGGCTTCTCTACGTAAAGTTGTACCAGTAGCTTCTGGTGGTATTCATGCTGGTCAAATGCACCAACTTCTTGATTACTTAGGTGATGACGTAGTTCTTCAATTTGGTGGTGGTACAATTGGACATCCTGATGGTATCCAAGCAGGTGCAACAGCAAATAGAGTTGCATTAGAGTCCATGGTTATGGCAAGAAATGAAGGTCGTAACTATGTAGCAGAAGGTCCTCAAATCTTAAGAGACGCTGCTAAAACTTGTGGACCTCTGCAAACAGCTTTAGACTTGTGGAAAGATATTAGTTTTAACTATACTTCCACAGATACAGCTGATTTCGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||