Barcode Identifiers

Sequence ID: ABMMC2670-08
Sample ID: GWS006445
Identified As: Pyropia sp. 1POR
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 661
TACTTTATATTTAATTTTTGGAGCTTTCTCTGGCATATTAGGCGCATGCGCATCTATATTAATCAGAATGGAACTAGCTCAACCTGGTAATCAACTTCTATTAGGCAATCATCAAGTATACAATGTACTAGTTACAGAGCACGCTTTCTTAATGATTTTTTTTATGGTTATGCCTGTATTAATTGGAGGGTTCGGGAATTGATTTGTACCAATTATGATAGGAGCGCCAGACATGGCTTTCCCAAGATTAAATAATATAAGTTTTTGACTATTACCCCCATCATTATGCCTTCTATTAGGTTCTGCTATGGTTGAAGTAGGTGCTGGTACAGGTTGAACTTTGTATCCACCTTTAAGTTCTATACAAAGTCATTCAGGTGGTGCTGTAGATCTTGCTATTTTTAGCTTGCATTTATCGGGTGCGTCTTCTATATTGGGTGCTATCAATTTTATTACGACCATATTTAACATGCGTAACCCAGGTCAGAGCATGTATCGTATACCTTTATTTGTTTGATCTATATTAATAACAGCTTTCTTATTGCTTTTAGCAGTACCTGTTTTAGCTGGGGCTATTACAATGCTACTAACTGATAGAAATTTCAACACTACATTTTTTGACCCTTCAGGTGGTGGTGATCCTGTGCTATACCAGCACTTG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||