Barcode Identifiers

Sequence ID: ABMMC2377-08
Sample ID: GWS007581
Identified As: Porphyra purpurea
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 664
TACCTTATATTTAATTTTTGGTGCATTCTCTGGTGTTCTAGGTGCCTGCGCATCCATATTAATCAGGATGGAGCTAGCCCAACCAGGTAATCAACTCCTTTTAGGTAACCATCAAGTTTATAATGTCTTAGTTACAGAGCACGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTACTAATAGGAGGGTTTGGTAATTGATTTGTGCCAATTATGATAGGAGCACCAGATATGGCATTCCCTCGATTAAATAACATTAGTTTTTGATTATTACCCCCATCACTATGTCTGCTCTTAGGATCCGCTATGGTTGAAGTAGGGGCAGGCACGGGCTGAACATTGTATCCACCGCTAAGTTCTATTCAAAGTCATTCTGGTGGCGCTGTTGATTTAGCTATTTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTAGGTGCTATTAACTTCATTACTACTATATTCAACATGCGTAACCCAGGACAAAGTATGTACCGTATCCCATTATTTGTGTGGTCTATCTTAATCACGGCTTTTTTATTGTTACTAGCTGTTCCTGTATTAGCAGGTGCTATTACAATGTTGCTTACCGATAGAAACTTCAATACCACATTTTTCGATCCGTCAGGTGGTGGAGATCCTGTGTTGTATCAACACTTGTTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||