Barcode Identifiers

Sequence ID: ABMMC2359-08
Sample ID: GWS006491
Identified As: Wildemania amplissima
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 664
AACATTATACCTAATATTTGGTGCTTTTTCTGGTATATTAGGTGCGTGTGCATCTATATTGATCAGGATGGAACTAGCCCAACCAGGTAATCAATTATTATTAGGAAATCACCAAGTCTACAACGTGTTAGTTACTGAGCATGCTTTCTTAATGATTTTTTTTATGGTAATGCCTGTCTTAATCGGAGGTTTTGGTAATTGGTTTGTACCGATCATGATCGGAGCTCCTGATATGGCGTTTCCCCGATTAAATAATATTAGTTTTTGATTGCTACCTCCTTCATTATGTCTTCTTTTAGGTTCTGCTATGGTAGAAGTAGGTGCAGGTACAGGATGAACTTTATATCCTCCATTAAGCTCAATTCAGAGCCATTCGGGCGGCGCTGTAGATTTAGCCATTTTCAGCTTGCATTTATCAGGAGCATCTTCAATATTAGGCGCTATTAATTTTATTACGACTATATTTAATATGCGTAATCCAGGACAAAGTATGTACCGCATACCTTTATTTGTCTGATCCATTTTAATCACAGCTTTTTTACTTTTATTAGCAGTACCCGTGTTAGCAGGCGCTATTACAATGTTACTAACAGACAGGAATTTTAATACTACATTCTTTGATCCGTCAGGTGGTGGTGACCCCGTTCTGTATCAGCATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||