Barcode Identifiers

Sequence ID: ABMMC1697-07
Sample ID: GWS005822
Identified As: Porphyra mumfordii
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 664
TACTTTATATTTGATTTTTGGCGCATTTTCTGGTATTCTAGGTGCATGTGCATCAATATTAATTAGGATGGAACTAGCTCAACCAGGTAACCAACTGCTTTTAGGAAATCATCAAATTTATAACGTATTAGTCACAGAGCATGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTATTAATAGGCGGGTTTGGTAATTGATTTGTACCTATTATGATAGGTGCACCAGACATGGCATTTCCTCGATTAAATAATATTAGTTTTTGATTATTACCCCCATCATTATGTCTTCTTTTAGGGTCAGCTATGGTTGAAGTAGGAGTAGGAACAGGTTGAACATTGTATCCCCCACTAAGTTCTATTCAAAGTCACTCTGGAGGAGCCGTTGATCTAGCTATTTTTAGTTTGCATCTATCGGGAGCTTCTTCTATACTTGGCGCTATTAATTTTATTACTACCATATTCAATATGCGCAATCCAGGGCAAAGTATGTACCGTATTCCATTATTTGTCTGATCGATCTTAATTACAGCTTTTCTGTTGTTATTAGCCGTTCCTGTATTAGCAGGTGCTATCACAATGTTACTCACGGATAGAAATTTTAATACCACATTTTTTGATCCTTCAGGCGGAGGTGACCCTGTTTTATATCAACATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||