Barcode Identifiers

Sequence ID: ABMMC1239-07
Sample ID: GWS003766
Identified As: Porphyra umbilicalis
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 664
TACTCTATATTTGATTTTTGGCGCATTTTCTGGTATTCTAGGTGCGTGTGCATCAATATTAATTAGGATGGAACTAGCTCAACCAGGCAACCAATTGCTTTTAGGAAATCATCAAATTTATAATGTATTAGTCACAGAGCATGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTATTAATAGGCGGGTTTGGTAATTGATTTGTACCTATTATGATAGGTGCACCAGACATGGCATTTCCTCGATTAAATAATATTAGTTTTTGATTATTACCCCCATCACTATGTCTTCTTTTAGGGTCAGCTATGGTTGAAGTAGGAGTAGGAACAGGTTGAACATTATATCCCCCACTAAGTTCTATTCAAAGTCACTCTGGAGGAGCCGTTGATCTAGCTATTTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTTGGTGCTATTAATTTTATTACTACCATATTCAATATGCGCAATCCAGGGCAAAGTATGTACCGTATTCCATTATTTGTCTGGTCTATCTTAATTACAGCTTTTCTGTTGTTATTAGCCGTTCCTGTATTAGCGGGTGCTATTACAATGTTACTCACGGATAGAAATTTTAATACCACATTTTTTGATCCTTCAGGTGGAGGTGACCCCGTTTTATATCAACATTTATTC
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||