Barcode Identifiers

Sequence ID: ABMMC1216-07
Sample ID: GWS002660
Identified As: Pyropia peggicovensis
Last Updated
Marker rbcL

Nucleotide Sequence

Residues: 1363
TTACTGGGATGCTGACTATGTAATTAAAGAAACAGATATTTTAGCTCTGTTCAGAATCACTCCTCAGCCAGGTGTTGACCCTATTGAAGCATCCGCTGCAATTGCAGGTGAATCTTCAACAGCTACTTGGACAGTTGTATGGACTGATTTGCTAACAGCTTGTGACCTATACAGAGCAAAAGCGTATCGAGTTGATCCAGTTCCAAATGTTGCAGATCAATACTTTGCTTACATCGCTTATGATATTGATTTATTTGAAGAAGGTTCCATTGCGAATTTAACTGCTTCAATTATTGGTAACGTTTTTGGATTTAAAGCTGTAAAAGCTCTTCGTCTAGAAGATATGCGTATGCCAGTAGCTTACCTAAAAACTTTCCAAGGTCCTGCAACTGGATTGATTGTAGAACGTGAGCGTATGGATAAATTTGGTAGACCTTTCCTAGGTGCTACGGTTAAACCTAAACTAGGTTTATCTGGTAAAAACTATGGAAGAGTAGTATATGAAGGTCTGAAAGGTGGTCTTGACTTCCTTAAAGATGATGAAAATATCAACTCACAACCATTTATGCGTTGGAGAGAAAGATTCCTATATTCCATGGAAGGTGTAAATAAAGCATCTGCTTCTGCTGGAGAAATTAAAGGTCATTACCTTAACGTAACAGCTGCGACTATGGAAGATATGTACGAGAGAGCAGAATTCTCCAAGGACGTTGGTAGCATCATTTGTATGATTGACCTTGTAATTGGTTATACTGCGATTCAAAGTATGGCAATCTGGGCTCGTAAGCATGATATGATTTTACATTTACATAGAGCAGGTAACTCTACTTACTCTCGTCAAAAAAATCATGGTATGAACTTCCGAGTTATTTGCAAATGGATGCGTATGGCAGGTGTTGACCATATTCACGCAGGTACAGTTGTAGGTAAACTTGAGGGAGATCCTTTAATGATTAAAGGTTTCTACAACACTTTACTTGAAAGTGATACAGATATCAATCTACCTCAAGGTCTATTCTTTGCTCAAAACTGGGCTTCCCTACGTAAAGTTGTACCAGTAGCATCTGGTGGTATTCATGCTGGTCAAATGCACCAACTTCTTGATTACCTAGGCGATGATGTAGTTCTTCAGTTTGGTGGTGGTACAATTGGACATCCTGATGGTATCCAAGCAGGAGCAACTGCAAACAGAGTAGCATTAGAGTCCATGGTTATGGCAAGAAATGAAGGTCGCAATTATGTAGCAGAAGGTCCACAAATCTTAAGAGACGCTGCTAAAACTTGTGGACCTCTACAAACAGCTTTAGATTTATGGAAAGATATTAGTTTTAACTATACTTCCACAGATACAGCTGATTTCGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||