Barcode Identifiers

Sequence ID: AADBE251-10
Sample ID: AAD-79500
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 658
AACTTTGTATTTTCTTTTAGGAATGTGATGTGGGTTGGTTGGCACAGGTCTTAGGCTACTTATTCGATTCGAATTAGGTACTGCTGGAGCTTTGTTAGGGGATGATCACCTATACAATGTGATTGTTACCGCCCATGCTTTCGTTATAATTTTTTTTACAGTAATGCCTTTAATAATTGGGGGGTTCGGAAACTGGATGGTTCCTCTGCTTATTGGAGCTCCGGACATAAGTTTTCCTCGGATAAATAATATAAGATTTTGATTGCTCCCACCCTCATTCATATTGCTTCTCTCTAGAACTTTAATAGAAGGAGGGGCAGGGACTGGATGAACTGTTTATCCCCCTTTATCAGGTCCTATAGGGCATGGAGGATGTTCTGTAGATTTTGCTATTTTTTCGCTACACTTAGCGGGTATATCTTCTTTGCTTGGGGCTATTAATTTTATTACAACTATTTTCAATATGCGGTCTCCTGAAATAACATGGGATCGTTTGAGATTGTTTGTTTGGTCTGTTTTGGTTACAGCTTTTCTTTTATTGTTAGCTTTGCCTGTTCTAGCTGGAGCAATTACTATGTTGCTCACTGATCGTAATTTCAATACTAGGTTTTTTGACCCAGCTGGTGGAGGTGACCCTATTTTATACCAGCATTTATTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||