Barcode Identifiers

Sequence ID: AADBE034-10
Sample ID: AAD-79416
Identified As:
Last Updated
Marker COI-5P

Nucleotide Sequence

Residues: 657
AACTTTATACTTCATATTTGGGGCCTGAGCTGGGATAGTTGGCACCTCCCTAAGTCTTTTAATTCGAGCTGAACTAGGACAGCCGGGAAGCCTTATTGGTAACGACCAAATTTATAATGTAATCGTGACTGCGCATGCTTTCGTAATAATTTTCTTCATGGTAATACCTATTATAATTGGAGGATTCGGAAACTGATTAGTTCCTCTGATATTAGGGGCCCCTGATATAGCTTTCCCCCGCATGAATAACATAAGGTTTTGGCTTTTGCCCCCTTCTCTAACGCTACTTCTCTCCAGAGGAATAGTAGAGAGAGGGGTCGGCACAGGTTGAACTGTTTACCCCCCCCTATCAAGAGGCATTGCTCATGCTGGGGCAAGGGTAGATCTCGGTATTTTCTCTCTCCACTTGGCGGGGGTTTCTTCCATCTTGGGAGCAGTTAATTTTATAACTACTGTTATTAACATACGGCCCGAAGGAATACCAATAGATCGCATACCGCTGTTTGTCTGATCCGTATTTCTAACCGCGGTCCTTTTACTACTGTCTCTTCCAGTTCTTGCTGGAGCTATTACTATATTACTCACTGATCGAAACTTAAACACTTCATTTTTCGACCCCGCCGGGGGCGGTGACCCAATTTTGTACCAACACTTGTT
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||