Specimen Information

Sample Storage
Sample ID: CNCLEP00075284
Catalog Number: CNCLEP00075284
Voucher Type: Dry mounting specimen
Voucher Description:
Institution Storing:
Identification Provided by: Eugene Munroe
Taxonomy
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Family:
Genus:
Species:
Sample Collection
Ocean:
Country: Honduras
State:
Region: Br
Exact Site: Middlesex
Latitude: 17.0397
Longitude: -88.5203
Coordinate:
Collectors: E. C. Welling
Collectiondate: 1964-08-02
Specimen Details
Sex: male
Life Stage: adult
Reproduction:
Notes:
   
   
   
   
   
   

Sequence Details

Sequence ID: ZYPAN952-10
Marker Code: COI-5P
Residues: 630
TACATTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGTGCAGAATTAGGAAATCCTGGATCATTAATTGGAGATGACCAAATTTATAATACCATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGATTACTCCCCCCATCATTAACTCTTTTAATTTCAAGCAGAATTGTTGAAAATGGAGCAGGAACTGGCTGAACTGTTTATCCCCCACTTTCTTCTAATATTGCCCATGGTGGAAGATCTGTTGATTTAGCTATCTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAGTTTATCATTTGATCAAATACCCTTATTTGTATGATCTGTTGGAATTACAGCATTACTTTTACTATTATCATTACCCGTTTTAGCTGGAGCTATTACTATACTTTTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCAGGGGGAGG
A:
G:
C:
T:
Ambiguous:

Illustrative Barcode

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||||||||||||||||||

Photograph

No image available currently!